We use cookies to make your experience better. To comply with the new e-Privacy directive, we need to ask for your consent to set the cookies. Learn about our cookie policy.
Roche Diagnostics Corporation Lambda Dnp Probe (826-855), Asr
List Price $1,011.73 Your Price $1,011.73
Roche Diagnostics Corporation Lambda Dnp Probe (826-855), Asr - ROCHMSD (Additional S&H or Hazmat Fees May Apply)
NETA PART: ROCHMSD-06543464001
MFG.PART: 06543464001
UNSPSC: 41116123
Manufacturer: Roche Life Science
Roche Diagnostics Corporation lambda dnp probe (826-855), asr; lambda dnp probe (826-855) is designed to bind to lambda light chain mrna. the probe is complementary to the lambda mrna sequence: 5gcccuucucccugcacucaauaaacccuca3. - ROCHMSD (Additional S&H or Hazmat Fees May Apply)
| SKU | ROCHMSD-06543464001 |
|---|---|
| Supplier Part Number | 06543464001 |
| UM | EA |
| UNSPSC | 41116123 |
| Manufacturer | Roche Life Science |
| MSDS URL | Click here |
| Refrigerated-Frozen | Refrig +2 to +8C |
| ProductLine | ROCHMSD |
| Qty | 1 |
| MinOrderQty | 1 |
| Depth | 2.2 |
| Height | 2.8 |
| Weight | 7.000000 |
| Lead Time | 5 |
| Hazardous | N |